pcmv n ha vector Search Results


pcmv n ha vector  (New England Biolabs)
99
New England Biolabs pcmv n ha vector
Indirect immunofluorescence of the transfected HEK293T cells. <t>The</t> <t>ROP18</t> protein tagged with HA was stained with AlexaFluor 555 (Orange) and the nucleus was counterstained with DAPI (Blue). The HEK293T cells transfected with <t>PCMV-N-HA-ROP18</t> showed high density of orange signal, whereas HEK293T cells transfected with PCMV-N-HA did not show any fluorescent signal.
Pcmv N Ha Vector, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcmv+n+ha+vector/BamHI/pmc07734210-45-7-15
Average 99 stars, based on 1 article reviews
pcmv n ha vector - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier
sali  (New England Biolabs)
97
New England Biolabs sali
Indirect immunofluorescence of the transfected HEK293T cells. <t>The</t> <t>ROP18</t> protein tagged with HA was stained with AlexaFluor 555 (Orange) and the nucleus was counterstained with DAPI (Blue). The HEK293T cells transfected with <t>PCMV-N-HA-ROP18</t> showed high density of orange signal, whereas HEK293T cells transfected with PCMV-N-HA did not show any fluorescent signal.
Sali, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcmv+n+ha+vector/SalI/custom%40r0138%4033330132
Average 97 stars, based on 1 article reviews
sali - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier
anhydrous hexanol  (Sinopharm ltd)
90
Sinopharm ltd anhydrous hexanol
Indirect immunofluorescence of the transfected HEK293T cells. <t>The</t> <t>ROP18</t> protein tagged with HA was stained with AlexaFluor 555 (Orange) and the nucleus was counterstained with DAPI (Blue). The HEK293T cells transfected with <t>PCMV-N-HA-ROP18</t> showed high density of orange signal, whereas HEK293T cells transfected with PCMV-N-HA did not show any fluorescent signal.
Anhydrous Hexanol, supplied by Sinopharm ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcmv+n+ha+vector/n+hexanol/pm39568047-50-73-81
Average 90 stars, based on 1 article reviews
anhydrous hexanol - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
dmem  (Sinopharm ltd)
90
Sinopharm ltd dmem
Indirect immunofluorescence of the transfected HEK293T cells. <t>The</t> <t>ROP18</t> protein tagged with HA was stained with AlexaFluor 555 (Orange) and the nucleus was counterstained with DAPI (Blue). The HEK293T cells transfected with <t>PCMV-N-HA-ROP18</t> showed high density of orange signal, whereas HEK293T cells transfected with PCMV-N-HA did not show any fluorescent signal.
Dmem, supplied by Sinopharm ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcmv+n+ha+vector/dmem/pm39568047-50-69-81
Average 90 stars, based on 1 article reviews
dmem - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
opti-mem medium  (Sinopharm ltd)
90
Sinopharm ltd opti-mem medium
Indirect immunofluorescence of the transfected HEK293T cells. <t>The</t> <t>ROP18</t> protein tagged with HA was stained with AlexaFluor 555 (Orange) and the nucleus was counterstained with DAPI (Blue). The HEK293T cells transfected with <t>PCMV-N-HA-ROP18</t> showed high density of orange signal, whereas HEK293T cells transfected with PCMV-N-HA did not show any fluorescent signal.
Opti Mem Medium, supplied by Sinopharm ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcmv+n+ha+vector/opti+mem+medium/pm39568047-50-64-81
Average 90 stars, based on 1 article reviews
opti-mem medium - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
bamhi  (New England Biolabs)
99
New England Biolabs bamhi
Indirect immunofluorescence of the transfected HEK293T cells. <t>The</t> <t>ROP18</t> protein tagged with HA was stained with AlexaFluor 555 (Orange) and the nucleus was counterstained with DAPI (Blue). The HEK293T cells transfected with <t>PCMV-N-HA-ROP18</t> showed high density of orange signal, whereas HEK293T cells transfected with PCMV-N-HA did not show any fluorescent signal.
Bamhi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcmv+n+ha+vector/BamHI/pmc07734210-45-10-15
Average 99 stars, based on 1 article reviews
bamhi - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier
5 ggccgctctagactcgagtttatcatttagatgaccccag 3 ha fbxo22 δ2  (OriGene)
97
OriGene 5 ggccgctctagactcgagtttatcatttagatgaccccag 3 ha fbxo22 δ2
Indirect immunofluorescence of the transfected HEK293T cells. <t>The</t> <t>ROP18</t> protein tagged with HA was stained with AlexaFluor 555 (Orange) and the nucleus was counterstained with DAPI (Blue). The HEK293T cells transfected with <t>PCMV-N-HA-ROP18</t> showed high density of orange signal, whereas HEK293T cells transfected with PCMV-N-HA did not show any fluorescent signal.
5 Ggccgctctagactcgagtttatcatttagatgaccccag 3 Ha Fbxo22 δ2, supplied by OriGene, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcmv+n+ha+vector/Primer/pm40263598-233-29-63
Average 97 stars, based on 1 article reviews
5 ggccgctctagactcgagtttatcatttagatgaccccag 3 ha fbxo22 δ2 - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier

Image Search Results


Indirect immunofluorescence of the transfected HEK293T cells. The ROP18 protein tagged with HA was stained with AlexaFluor 555 (Orange) and the nucleus was counterstained with DAPI (Blue). The HEK293T cells transfected with PCMV-N-HA-ROP18 showed high density of orange signal, whereas HEK293T cells transfected with PCMV-N-HA did not show any fluorescent signal.

Journal: Frontiers in Cellular and Infection Microbiology

Article Title: ROP18-Mediated Transcriptional Reprogramming of HEK293T Cell Reveals New Roles of ROP18 in the Interplay Between Toxoplasma gondii and the Host Cell

doi: 10.3389/fcimb.2020.586946

Figure Lengend Snippet: Indirect immunofluorescence of the transfected HEK293T cells. The ROP18 protein tagged with HA was stained with AlexaFluor 555 (Orange) and the nucleus was counterstained with DAPI (Blue). The HEK293T cells transfected with PCMV-N-HA-ROP18 showed high density of orange signal, whereas HEK293T cells transfected with PCMV-N-HA did not show any fluorescent signal.

Article Snippet: The purified ROP18 CDS was cloned into PCMV-N-HA vector using BamHI and SalI restriction enzymes (NEB, USA), according to the manufacturer’s instructions.

Techniques: Immunofluorescence, Transfection, Staining